SHARE

Hoy se llevó a cabo la presentación de las nuevas camisetas Penalty de Racing. Los hinchas esperaron ansiosamente esta nueva colección a cargo de la marca brasileña que entrara de vuelta al mercado local con Vélez a principios del año pasado. Seguramente, este nuevo esfuerzo de Penalty caiga bien entre los hinchas, ya que recobra un estilo más clásico en distintos aspectos.

La nueva camiseta mejora un poco el primer trabajo de Penalty con Racing. Desaparecen los toques de blanco y los loguitos en los hombros, y el celeste pasa a ser un poco más claro como reclamaban muchos fanáticos. Además, el escudo del club vuelve a ubicarse sobre la izquierda, con el logo de la marca centrado debajo del cuello. La camiseta lleva un corte bastante común, con paneles en blanco y borde azul sobre los costados como único detalle destacable.

La camiseta suplente mantiene el color azul de la anterior, aunque en este caso se cambia el gris y ahora lleva una banda horizontal a la altura del pecho dividida en celeste arriba y abajo, con blanco al centro. Este modelo rememora la camiseta que se utilizara entre 1949 y 1951 cuando Racing obtuvo el campeonato nacional 3 veces en forma consecutiva. El corte es igual a la titular, en este caso con cuello en blanco al frente y el detalle de costuras en blanco que se destacan al frente.

¿Te gustaron las nuevas camisetas de Racing? ¿Te parece que son mejores o peores que las anteriores?

SHARE
Uruguayo, fanático y coleccionista moderado. A los 18 años comencé TSC como una pequeña distracción y hoy superviso el día a día del gran equipo detrás del blog.

Me gustaban mucho más las de Nike. Sobre todo las alternativas.
De todos modos, si a la hinchada le gustan así, tan clásicas, tampoco me parece mal. Lo único feo q le veo (aparte de las medias grises) es el cuello en blanco de la alternativa

Me gusta la titular pero la suplente es una verguenza sinceramente, no me gusta absolutamente nada, lo unico el pantalon blanco en vez del hjorrible gris:

Las medias grises son un azco

La vestimenta titular me gusta, menos el cuello de la camiseta y las medias grises, las cuales para mi quedan descolgadas.
La camiseta suplente no me gusta, hubiera hecho las bandas del mismo tamaño y con el mismo celeste que la camiseta titular, el utilizado me parece apagado.
Saludos Sergio Gustavo MUÑOZ

QUE TE PASA PENALTI !!!! Las camisetas son HORRIIIIBLESSSS mas aun la suplente.Son para un equipo de la "C".Cambienlas YA ! por Favorrrr ! Quiero dar la vuelta olimpica con una que tenga un diseño mas hermoso y no estas.AGUANTE LA ACADEMIA DE MI CORAZON !!!!!!!!!!!!!

Eeeeeeeehhhhhhhhhhhhhhhhhhh……………..eeeeeeeeeeeeeeeeehhhhhhhhhhhhhhhhhhhhh, bueno eeeeeeeeeeeeeeeeeeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhhh, no se que decir , eeeeeeeeeeeeehhhhhhhhhhhhhhhhhhhh, es obvio que la titular esta mucho mejor que la suplente pero no llegan a tener ese gggguuuuuuaaaaaaauuuuuuuuu que hace rato espero por una linda camiseta de la academia, pero quien te dice che……. a lo mejor es la que nos hace dar la vuelta quien dice verdad y ahi la vamos a adorar, pero bueno aguante la acade es lo mejor que hay, rojito cuidate que en este campeonato te rompemos el culo….. jeje

No se ofendan, con la titular, todo bien , pero Racing con la suplente no la pega desde el 2001, la unica camiseta suplente linda de Racing fue con la que salió campeón ese año, que era negra con unas franjas celestes

NO ME GUSTA PARA NADA! RACING SE MERECE ALGO MEJOR! LAMENTABLEMENTE A PENALTY LE QUEDA GRANDE RACING Y VELEZ! LOS 2 NUEVOS MODELOS DE ESTOS CLUBES SON HORRIBLES! LOS CUELLOS.. SOBRE TODO DE LA SUPLENTE.. UN ASCO! LAS FRANJAS DE LA SUPLENTE.. MUY GRUESAS.. DEMASIADO! COINCIDO CON LA MARORIA DE LOS COMENTARIOS LAS MEDIAS DE LA 1 GRISES QUEDAN MUY MAL! LA VERDAD QUE EL MODELO ANTERIOR NO ME GUSTABA.. PERO ESTE.. MUCHO PEOR! ANDATE PENALTY.. NI BOTINES SABES HACER! OLYMPIKUS EN POCO TIEMPO TE SUPERO 10.000 MEJOR! UNA MARCA PARA TENER EN CUENTA! RACING PROX NIKE, ADIDAS, PUMA, OPKUS

muy bonita, salvo por el cuello blanco que no me gusta, por lo demas, muy linda camiseta

Linda casaca, me gusta, bien de Racing. La suplente es feucha. Espero que no usen las medias grises.

la camiseta esta buena,y aparte es verdad hacen lo q pueden,y tampoco es tan fea como umbro,wakale!!!!la mejores casacas son las nike,adidas y la indiscutida topper,con la q salimos campeones!!!

a mi me gustan las dos, mas la titular, mientras tengan celexte y blanco, para mi es suficiente. no tengo idea como es la calidad. lo que no me parece para nada bueno es q no tenga la estrella, una falta de respeto, por un lado hacen homenaje al tri campeon, y por el otro se olvidan del primer campeon argentino del mundo, mal ahi. waly el academico

Vamo la academia vamo la acade!!!
no me interesa como es la camiseta yo soy de Racing hasta la muerte… vamo la akd

No es tan mala la titular, la suplente si que es fea y no me gustan las medias !!!!

LA RAMERA DE RACING SIEMPRE SON LAS MEJORES NO HAY DUDA ES LA MEJOR DEL MUNDO LES MANDO MI CORREO dmilito2001@hotmail.com para comprar la ultima camiseta AGUANTE RACING CLUB DE LA REPUBLICA DE PERU PARA TODO EL MUNDO LOCO

racing me esta re guena la camiseta lastima qe perdimos con independiente con la camiseta sigamos jugemos como cuando jugamos con atletico tucuman suludo inchas de racing el mejor equipo del mundo

las camisetas son un asco, me estoy comprando las nike que consigos que para mi gusto son las mejores de racing lejos! incluso mejores que las adidas del 2000 del primer campeon del mundo las tengo a las 3 la titular, suplente y con la que atajaba sessa las voy a vender para terminar de comprarme las nike que me faltan saludos y aguante racing!!!

Ah! y hay otros 2 Racing +,está el Racing Club de Lens de Francia,que por cierto,tiene unos colores muy mal combinados.El rojo queda lindo,pero si le agregás amarillo es un combo fatal.Y el otro,también de Francia,es el Racing de Estrasburgo (donde atajó José Luis Chilavert antes de jugar acá en Uruguay,en Peñarol) pero éstos son mas displicentes y optaron x el uniforme todo azul.Linda ropa.

bueno meparece que las camisetas son malisimas , las dos .
Parami RACING es un grande y los equipos grandes tienen que tener
camisetas grandes no como penalty ,tiene que tener nike el escudo al lado con la estrella arriba y el macro y la camiseta con rayas celestes y blancas y la suplente igual pero toda negra .
Si la hacen así va a ser una camiseta buenisima .